ISSN 2079-6617 (Print)
ISSN 2309-9828 (Online)
Ru | En
РПО
Факультет психологии МГУ имени М.В. Ломоносова
Главная RSS Поиск

ГлавнаяВсе статьи журналаНомера

Поликанова И.С., Коршунов А.В., Леонов С.В., Веракса А.Н. Ассоциация рецептора к дофамину второго типа (DRD2) с развитием утомления в результате длительной когнитивной нагрузки. // Национальный психологический журнал. – 2016. – № 3(23). – С. 115-126.

Автор(ы): Поликанова И.С. ; Коршунов Алексей Владимирович; Леонов С.В.; Веракса А.Н.;

Аннотация

Данное исследование посвящено изучению влияния длительной когнитивной нагрузки на развитие утомления по комплексу субъективных (тест САН), поведенческих (время реакции) и электрофизиологических (индивидуальный альфа-ритм (ИАР), индекс утомления (ИУ)) параметров у носителей различных полиморфизмов гена DRD2. Умственное утомление моделировалось с помощью непрерывного решения испытуемым когнитивных заданий, направленных на использование внимания и рабочей памяти, в течение 2,5 часов.

В данном исследовании приняли участие 51 испытуемый (мужчины-правши, средний возраст – 20±4 лет). Для данных испытуемых был проведен генетический анализ и определены варианты полиморфизма Taq1A гена DRD2 (A1A1, A1A2 и A2A2).

Как показывают результаты исследования, такая нагрузка значимо отражается практически на всем комплексе показателей. Обнаружены значимые различия между носителями полиморфизмов A1A1 и A1A2 и полиморфизма A2A2 гена DRD2 в реакции выбора, а также по индексу утомления, отражающему отношение медленных ритмов мозга к быстрым. Полученные результаты свидетельствуют о положительной роли дофамина в развитии утомления.

Группа носителей полиморфизма А2А2 («А1 »), который, как мы предполагали, будет показывать меньшее развитие утомления, характеризуется в ПЗМР и РВ значимо более медленным временем реакции и до и после длительной когнитивной нагрузки, по сравнению с носителями полиморфизмов А1А1 и А1А2 («А1+»). Стоит отметить, что динамика увеличения ошибок у всех полиморфизмов одинакова и по количеству ошибок генотипы не различаются ни до, ни после утомления. При этом направленность динамики изменения времени реакции после утомления у всех полиморфизмов примерно одинакова. Это означает, что полиморфизмы различаются в ПЗМР и РВ не динамикой развития утомления, а физиологической предрасположенностью к сенсорной обработке информации.

Страницы: 115-126
Поступила: 16.08.2016
Принята к публикации: 02.09.2016
DOI: 10.11621/npj.2016.0314

Разделы журнала: Нейропсихология;

Ключевые слова: утомление; когнитивная нагрузка; ЭЭГ; данные ЭЭГ; индивидуальный альфа ритм; индекс утомления; спектральные характеристики; дофамин;

PDF: /pdf/npj-no23-2016/npj_no23_2016_115-126.pdf

Доступно в on-line версии с 30.11.2016

В многочисленных исследовани­ях (Newsholme, 1992, 1995; Davis, 1997, 2000; Salamone et al, 1999, 2010a, 2010b; Blomstrand, 2001; Nieoullon, 2002; Lorist et al, 2005; Fernstrom, 2006; Meeusen R, 2007; Gosso, 2008; Foley et al., 2008; Malyuchenko N et al., 2009; Bolton, 2010; Barnes, 2011; Polikanova I.S.et al, 2012; Khaustova et al, 2010; Shkurnikov et al, 2008; Зинченко и др., 2011) была по­казана связь между утомлением и уровнем концентрации определенных нейромеди­аторов, преимущественно с дофамином и серотонином. Определенный уровень концентрации данных нейромедиаторов зависит от наличия тех или иных полиморфизмов, связанных с транспортировкой, удалением этих нейромедиаторов, а также с плотностью рецепторов для них.

Многие ученые сходятся в том, что дофаминергическая система играет важ­ную роль в формировании когнитив­ной сферы человека. В настоящее время проводится все больше научных иссле­дований, посвященных изучению гене­тических основ поведения, важную роль в котором играет дофаминергическая система мозга. Перспективными канди­датами для изучения генетической при­роды поведения являются гены, коди­рующие ключевые белки, участвующие в передаче дофаминергического сигна­ла, синтезе дофамина, его высвобожде­ния в синаптическую щель. Исследова­ния последних лет показали, что в мозге млекопитающих обнаружено несколько типов дофаминергических рецепторов. Основными типами дофаминовых ре­цепторов являются Д1- и Д2-рецепторы.Недавно были открыты также рецепто­ры ДЗ, Д4 и Д5.Рецепторы дофамина ло­кализованы как на пре-, так и на постси­наптической мембране. Предполагается, что пресинаптические ауторецепторы, принадлежащие к Д2 и Д3 подтипу, мо­гут находиться на соме, дендритах и нервных терминалях. Они принимают участие в регуляции процессов синтеза и высвобождения дофамина во внекле­точное пространство. Для постсинапти­ческих (Д1, Д4, Д5) рецепторов харак­терна локализация не только в области синаптического контакта, но и в значительном удалении от нее, что говорит о возможном действии медиатора вне си­наптических терминалий.

Рецептор дофамина второго типа (DRD2, Д2-рецептор) относится к ауторецепторам, принимающим участие в регуляции процессов синтеза и выс­вобождения дофамина во внеклеточное пространство. Стимуляция Д2-рецепто­ров приводит к торможению передачи нервного импульса в симпатических ган­глиях, снижению выделения дофамина и норадреналина из симпатических окон­чаний.Д2-рецептор ингибирует адени­латциклазу и Ca-канал, но активирует K-канал.Д2-подобные рецепторы пре­обладают в стриатуме – хвостатом ядре и скорлупе, но имеются также в поясной извилине и коре островка (Joyce, 1986).

Одним из наиболее хорошо изучен­ных полиморфизмов гена DRD2 является полиморфизм TaqIA. Он определяет плот­ность рецепторов дофамина второго типа в синаптической щели. У носителей ал­леля А1 наблюдается 30-40% уменьшения плотности этих рецепторов, по сравне­нию с плотностью рецепторов у носите­лей генотипа А2А2.Аллель А1 встречает­ся в популяции россиян с частотой 0,172, а аллель А2 – 0,828 (Kidd, 1998).

В нескольких работах было показа­но, что аллель A1 ассоциирован со сни­жением уровня дофамина в ЦНС. Также известно, что наличие аллеля A1 ведет к снижению сродства рецепторов к до­фамину (Ritchie, 2003) и к уменьшению плотности дофаминовых рецепторов второго типа в стриатуме (Thompson, 1997). Считается, что стриатум является структурой принятия решения на уров­не поведенческих реакций и одним из отделов головного мозга, отвечающих за регуляцию адаптивного поведения.

Рецептор Д2 был исследован на пред­мет ассоциации с чертами характера. Цай и соавторы обнаружили ассоциацию аллеля А1 с высоким уровнем интеллекта у женщин (Tsai, 2002). Исследования за­висимости полиморфизма TaqIA от такой черты поведения, как креативность, показали, что носители аллеля А1 обладают повышенном уровнем индекса вербаль­ной и общей креативности (Reuter, 2006). Посредством TPQ опросника было пока­зано, что у носителей аллеля А1 наблюда­ются повышенные показатели по шкале “поиска новизны“ (Kaasinen, 2004).

Исследования в области психофизи­ологии утомления показывают, что раз­личные показатели ЭЭГ коррелируют с параметрами утомления. К таким по­казателям ЭЭГ можно отнести увеличе­ние мощностей медленных ритмов (тета- и альфа-ритмов), индивидуальный аль­фа-ритм, индекс утомления. Многие ис­следования показывают общие тенденции в динамике различных параметров (субъ­ективных, поведенческих, электрофизио­логических) в условиях длительных когнитивных нагрузок. Особенности сдвигов, как правило, связаны со специфичностью выполняемых заданий. Так, многочислен­ные исследования показывают, что аль­фа-ритм хорошо видно в состоянии фи­зического и умственного расслабления (Golojahani, 2012). На ЭЭГ, зарегистриро­ванной в спокойном состоянии, обычно хорошо заметен отдельный пик на часто­те альфа ритма (8-14 Hz). Данный пара­метр имеет высокую интраиндивидуаль­ную стабильность (Binni, 2003; Fernandez, 1993), а также достаточно сильную вариацию между отдельными людьми и из­менчивость с возрастом (Klimesh, 1999) в исследовании Питерсона было показано, что у взрослого человека среднее значе­ние индивидуального альфа пика состав­ляет 10.2+/-0.9 Гц (Peterson, 1971). В целом ряде исследований показано, что альфа пик характеризуется увеличением с детст­ва до пубертата (Epstein, 1980). У взрослых людей, наоборот, альфа пик характеризу­ется уменьшением с возрастом – с 20 до 70 лет его частота уменьшается в среднем с 10,89 Гц до 8,24 Гц (Klimesh, 1997).

Различные исследования показывают, что пик альфа ритма положительно кор­релирует с успешностью выполнения ког­нитивных функций таких, как внимание, память, скоростью протекания инфор­мационных процессов (Angealakis, 2004; Klimesh, 1999). Частота индивидуального альфа ритма возрастает больше в правом полушарии при выполнении зрительных заданий и больше в левом при выполне­нии арифметических заданий (Angealakis, 2004). Климеш показал, что испытуемые со сниженными мнестическими способно­стями характеризуются снижением пика альфа ритма во время выполнения зада­ний на память, а испытуемые с высокими мнестическими способностями характе­ризуются стабильностью пика альфа рит­ма в различных условиях (Klimesh, 1993). Также Климеш показал, что испытуемые с высокими мнестическими способно­стями и высокой скоростью обработки информации характеризуются частотой альфа пика в среднем на 1 Гц большей по сравнению с контрольной группой (Klimesh, 1996, 1997). Предыдущие иссле­дования выявили, что целый ряд психи­ческих заболеваний также связан со сни­жением частоты индивидуального альфа пика – болезнь Альцгеймера, шизофре­ния, синдром хронического усталости, по­лушарный инсульт (Angealakis, 2004).

Интересным параметром для диагно­стики сдвигов функционального состо­яния является так называемый индекс утомления (ИУ), отражающий отноше­ния ритмов ЭЭГ. Ученые исследовали не­сколько таких индексов, показывающих отношения различных ритмов. Ченг с соавторами исследовали также эффек­тивность использования различных ал­горитмов, отражающих соотношение мощностей ритмов ЭЭГ, для определе­ния состояния утомления. В своем исследовании они использовали 3 индекса: тета/альфа, бета/альфа, (альфа+тета)/бета. В ходе эксперимента было пока­зано, что лучшие результаты по детек­ции утомления были получены с помо­щью индекса (альфа+тета)/бета (Cheng, 2011). Джап с соавторами также исследо­вали различные алгоритмы вычисления индекса утомления: ((тета+альфа)/бета, альфа/бета, (альфа+тета)/(альфа+бета), тета/бета) (Jap, 2009). Они, также как и Ченг, продемонстрировали, что алгоритм (тета+альфа)/бета имеет наибольшее уве­личение после длительной когнитивной нагрузки и является наиболее чувстви­тельным к изменениям функционально­го состояния по сравнению с остальными. Джап выявил, что данный индекс наибо­лее сильно увеличивается в центральных, теменных и височных областях при за­крытых глазах и в теменных и височ­ных областях при открытых глазах. Также Джап показал увеличение дельта и тета ак­тивности во фронтальных, центральных и теменных регионах (Jap, 2009).

Гипотеза исследования

Основной гипотезой исследования является предположение о том, что но­сители полиморфизма A2A2 гена DRD2 характеризуются меньшим развитием утомления в условиях длительной когнитивной нагрузки по сравнению с но­сителями A1 аллеля (A1A1 и A1A2 поли­морфизмы) по комплексу параметров (субъективных, поведенческих и элек­трофизиологических).

Методика исследования

Испытуемые и методики

В данном исследовании приняли учас­тие 51 испытуемый (мужчины-правши, средний возраст – 20±4 лет). Для данных испытуемых был проведен генетический анализ и определены варианты поли­морфизма Taq1A гена DRD2 (A1A1, A1A2 и A2A2). Схема эксперимента состояла из двух одинаковых блоков длительностью около 35 минут, разделенных серией раз­личных когнитивных заданий, направлен­ных в основном на использование вни­мания и рабочей памяти, длительностью около 2–2,5 часов. Каждый из двух блоков состоял из трех этапов: 1.Заполнение пси­хологического опросника САН (методика диагностики Самочувствия, Активности и Настроения); 2.Выполнение тестов на время реакции; 3.Запись ЭЭГ.

Методика САН заполнялась на компьютере непосредственно перед выполнением основных серий экспе­римента (заданий на время реакции и записи ЭЭГ). В исследовании исполь­зовались три вида заданий на время ре­акции: простая зрительно-моторная реакция (ПЗМР), реакция выбора (РВ) и максимальный теппинг (МТ). В серии с ПЗМР от испытуемого требовалось как можно быстрее нажимать на «кнопку 1» при появлении красного крестика в цен­тре экрана. В серии с РВ испытуемый должен был, при появлении красного крестика в центре экрана, нажимать так­же на «кнопку 1», а при предъявлении зеленого крестика - «кнопку 2». В серии с МТ испытуемый должен был нажимать «кнопку 1» с максимально возможной скоростью в течение одной минуты.

Стимульный материал

Для предъявления стимульного ма­териала использовалась программа E-prime (версия 1.2). Стимулы предъ­являлись на мониторе фирмы Dell с раз­решением экрана 1280×1024 пикселей. Все стимулы предъявлялись на черном фоне. Фиксационная точка находилась в центре экрана в виде белого крестика (Courier New, размер 18).

Для ПЗМР и РВ заданий длительность фиксационной точки и стимула находи­лась в промежутке между 500-1500 мс. В ПЗМР стимулом служил красный кре­стик в центре экрана (Courier New, размер 72). В РВ стимулом был красный кре­стик (Courier New, размер 72) и зеленый крестик (Courier New, размер 72), кото­рые предъявлялись в случайной последо­вательности. В обоих заданиях перед вы­полнением основной серии, испытуемые выполняли тренировочную серию из 10 стимулов. Основная серия же состояла из 70 стимулов. При анализе данных учиты­вались стимулы только из основной се­рии. В максимальном теппинге испыту­емые нажимали на кнопку в течение 60 секунд. Через 60 секунд выполнение зада­чи автоматически останавливалось.

Запись ЭЭГ

Запись ЭЭГ в данном исследовании про­водилась дважды: первый раз до когнитив­ной нагрузки, второй раз – после. Запись ЭЭГ проводилась с помощью 256-каналь­ного электроэнцефалографа фирмы EGI Electrical Geodesics с частотой оцифровки 500 Гц и референтом в вертексе. Фоновая ЭЭГ состояла из двух периодов записи – 1 минуты с закрытыми глазами и 1 мину­ты с открытыми глазами. После записи ЭЭГ проводился ремонтаж и фильтрация в полосе от 1 до 150 Гц и удалением 50 Гц наводки от сети.Каждая запись ЭЭГ была автоматически просканирована на нали­чие артефактов. Участки ЭЭГ с амплиту­дой более 200 мкВ в пределах окна в 640 мс отмечались как плохой канал, участки с амплитудой более 140 мкВ рассматрива­лись как двигательный артефакт, а более 55 мкВ – как зрительный артефакт (Net Station software).

Анализ данных

Для статистического анализа данных использовались пакет Statistica 8 (для Windows, V 8.0, StatSoft), а также пакет MatLab (версия R2007b). Статистические методы ANOVA и Т-тест для зависимых выборок были использованы для анализа влияния длительной когнитивной нагруз­ки на время реакции и субъективное со­стояние.

Для различных экспериментальных заданий (ПЗМР, РВ, МТ) и психологиче­ского опросника САН были вычислены средние значения и стандартные откло­нения. Для реакции выбора, также было вычислено количество ошибок.

Для анализа ЭЭГ использовались от­резки фоновой ЭЭГ длительностью 20 секунд с наименьшим содержанием ар­тефактов, зарегистрированные в состоя­ниях с закрытыми и открытыми глазами. На основе данных ЭЭГ были рассчитаны частота индивидуального альфа ритма (ИАР) и индекс утомления (ИУ). Индиви­дуальный альфа ритм рассчитывался как частота, на которой наблюдается макси­мальная мощность альфа ритма в диапа­зоне от 7 до 14 Гц. Подсчет индивидуаль­ного альфа ритма проводился с помощью программы MatLab. Индекс утомления был рассчитан как отношение суммы мощностей медленных ритмов (альфа и тета ритмов) к мощности быстрого ритма (бета): ИУ = (альфа + тета) / (бета)) (Jap et al, 2009, Cheng, 2011).

Генетический анализ. Методика генотипирования DRD2

Проводили полимеразную цепную реакцию (ПЦР). Полиморфизм опреде­ляли по длине продуктов после рестрик­ции.ДНК выделяли из 100 мкл цельной крови с помощью наборов «ДНК-сорб Б» производства ЦНИИЭ (Россия). Реак­цию проводили в объеме 25 мкл. Стан­дартная реакционная смесь включала: 67 мМ Трис-НCl (рН 8,4), 16 мМ суль­фата аммония, 2,5 mM MgCl2, 0,125 мг/ мл бычьего сывороточного альбумина, 8% глицерин, 0,001% ксиленцианол, 2,5 Ед Taq-ДНК-полимеразы (ЦНИИЭ, Россия), 0,2 мМ каждого из четырех дезок­синуклеозидтрифосфатов и по 8 пмоль праймеров. При постановке ПЦР обяза­тельно использовали технику «горячий старт», который обеспечивался разделе­нием нуклеотидов с праймерами и Taq-полимеразы прослойкой воска.

Для ПЦР-амплификации использова­ли следующие праймеры, фланкирую­щие полиморфный участок гена DRD2 (Farde L., Gustavsson J.P., Jonsson E., 2007).

5’-ССGTCGACCCTTCCTGAGTGTCAT CA-3’ прямой

5’-CCGTCGACGGCTGGCCAAGTTGTC TA-3’ обратный

Ожидаемая длина продукта амплифи­кации 310 п.о. для обоих аллелей. ПЦР проводили по следующей программе в ам­плификаторе Терцик (ДНК-технология):

94°С – 4 минут ¬– 1 цикл;

94°С – 30 сек., 58°С – 30 сек., 72°С – 30 сек; всего 35 циклов;

72°С – 5 мин – 1 цикл;

Хранение: +10°С.

Затем к 7.5 мкл каждого образца до­бавляли определенное количество ре­стриктазы Taq I, эквивалентное 5 едини­цам активности фермента и проводили рестрикцию амплифицированных про­дуктов в течение 22 часов при 65°С в су­ховоздушном термостате.

Мутантный аллель А1 не расщепляет­ся.А2 аллель (дикий тип) расщепляется на продукты длинной 130 и 180 п.о.

Детекцию продуктов проводили с по­мощью электрофореза в 3% агарозном геле. Гель готовили на ТАЕ-буфере (0,1 М трис, 0,1 М уксусная кислота, 2 мМ ЭДТА, рН 8,3) с добавлением бромистого эти­дия до конечной концентрации 0,00001 %. Электрофорез проходил с охлажде­нием при напряжении 100 V в течение 1 часа. Результат детектировали на тран­силлюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

Результаты

По данным генетического анализа в данной выборке по гену DRD2 были вы­делены следующие группы: наличие по­лиморфизма A1A1 – 1 человек, A1A2 – 14 человек, A2A2 – 36 человек. Носители полиморфизмов A1A1 и A1A2 были объ­единены в одну группу «А1+» на основе литературных данных, которые показы­вают, что наличие аллеля А1 приводит к уменьшению плотности рецепторов до­фамина в синаптической щели на 30-40 %, по сравнению с плотностью рецепто­ров у носителей генотипа А2А2, которые были объединены в группу «А1-».

Субъективные показатели

Методика САН

Статистический анализ показал, что в состоянии утомления, вызванном дли­тельной когнитивной нагрузкой, проис­ходит значимое снижение субъективных ощущений по шкалам Самочувствие, Активность и общему баллу (таблица 1). При этом значимых различий между группами «A1-» и «A1+» не наблюдается. Полученные результаты говорят о том, что на субъективном уровне все испыту­емые испытывали некоторое утомление после прохождения эксперимента, но значимых различий у носителей разных полиморфизмов не наблюдалось.

Таблица 1. Методика САН (ген DRD2)

 

Самочувствие

Активность

Настроение

Общий балл

A1+

5.4/4.4**

5.1/4**

5.4/5.2

5.3/4.5**

A1-

5.5/4.7**

5/4.3**

5.4/5.2

5.3/4.8**

До утомления/после утомления, шкала: 1-7 баллов

Поведенческие показатели

Простая зрительно-моторная реакция (ПЗМР)

Статистический анализ ANOVA по­казал, что в целом наблюдается значи­тельное снижение скорости в состоя­нии утомления, вызванном длительной когнитивной нагрузкой (F(1,47) =6,479; p<0,01). Также результаты исследова­ния продемонстрировали, что две груп­пы носителей полиморфизмов «A1+» и «A1-» значимо различаются между со­бой: F(1,47) =6,960; p <0,01. Группа «A1-» характеризуется значимо более высо­кой скоростью реакции, по сравнению с группой «A1+».

Таблица 2. Простая зрительно-моторная реакция

DRD2

До утомления, мс (ст.откл.)

После утомления, мс (ст.откл.)

A1+

221.9 (16.4)

227.6 (14.4)

A1-

232.3 (21.1)

243.6 (30)*

*значимые изменения (p≤0.05)

Реакция выбора

Статистический анализ ANOVA по­казал, что в целом наблюдается умень­шение времени реакции выбора после утомления (F(1,47) =12,869; p<0,0008). Также было выявлено, что полиморфиз­мы «A1+» и «A1-» значимо различаются между собой (F(1,47) =5,643; p<0,02). Ана­лиз данных ANOVA продемонстрировал, что количество ошибок значимо возра­стает в целом (F(1,47) =9,6754; p<0,004), но между собой полиморфизмы не раз­личаются по количеству ошибок.

Таблица 3. Реакция выбора

 

Время реакции, мс

ОШИБКИ

DRD2

До утомления

После утомления

До утомления

A1+

400.2 (43.9)

377.9 (44.9)**

6.1

A1-

430.1 (60.1)

413.6 (59.5)*

6.1

*значимые изменения (p≤0.05);

** значимые изменения (p≤0.01)

Максимальный теппинг

Статистический анализ ANOVA не вы­явил значимых различий между поли­морфизмами в максимальном теппинге в гене DRD2.При этом у группы «A1+» наблюдается значимое снижение ско­рости (F(1,28) =6,30; p<0,02), тогда как у группы «A1-» – нет.

Таблица 4. Максимальный теппинг

DRD2

До утомления, мс

После утомления, мс

A1+

170(16)

175(12)

A1-

175(18)

172(19)

ЭЭГ результаты

Частота индивидуального альфа ритма (ИАР)

Статистический тест ANOVA не выявил значимых изменений ИАР после утом­ления у групп «A1+» и «A1-». При этом у носителей A2A2 полиморфизма ИАР не уменьшается, а у носителей А1 алле­ля – наблюдается значимое уменьшение ИАР в обоих полушариях (F(1,11) =7,678; p<0,02).

В таблице 5 представлены показате­ли средних значений ИАР со стандартны­ми отклонениями для обеих групп «A1+» и «A1-» до и после утомления. Группа «А1-» ха­рактеризуется в целом большим значением ИАР, по сравнению с носителями «A1+». Результаты Т-теста показали, что после ког­нитивной нагрузки значимых изменений по показателю ИАР у группы «A1-» не наблюдается, а вот группа «A1+» характеризу­ется значимым снижением частоты ИАР во фронтальной, теменной, затылочной об­ластях, а также в среднем по всему скальпу.

Таблица 5. ИАР до и после утомления у гена DRD2

Области мозга

ИАР, Гц/ст.откл.

«A1+» группа

«A1-» группа

До утомления

После утомления

До утомления

После утомления

Лобная левая

10,10 (0,88)

9,53 (1,02)*

9,63 (0,96)

9,69 (1,01)

Лобная правая

10,06 (0,87)

9,43 (1,06)*

9,77 (0,96)

9,72 (1,08)

Центральная левая

9,84 (0,70)

9,45 (1,10)

9,75 (0,98)

9,77 (1,10)

Центральная правая

9,77 (0,79)

9,30 (1,07)*

9,73 (1,03)

9,68 (1,03)

Теменная левая

9,89 (0,85)

9,68 (0,97)

9,96 (0,99)

10,04 (1,04)

Теменная правая

10,23 (0,43)

9,73 (0,74)

10,10 (1,02)

10,01 (0,99)

Височная левая

9,96 (0,92)

9,69 (1,14)*

9,81 (0,95)

9,73 (0,96)

Височная правая

10,18 (0,51)

9,60 (0,91)*

9,89 (0,93)

9,80 (0,96)

Затылочная левая

10,14 (0,82)

9,57 (0,77)*

9,97 (1,05)

9,90 (0,97)

Затылочная правая

10,35 (0,53)

9,69 (0,70)*

10,01 (0,98)

9,90 (0,90)

*значимые изменения (p≤0.05);

** значимые изменения (p≤0.01)

Индекс утомления

В таблице 6 показаны средние значе­ния параметра индекс утомления (ИУ) со стандартными отклонениями для обеих групп «A1+» и «A1-» до и после когнитивной нагрузки. Носители А1-аллеля характеризуются в целом большим значением индекса утомления, по срав­нению с носителями А2-аллеля в фо­новом состоянии. Результаты Т-теста показали, что после утомления более сильное увеличение индекса утомления наблюдается у группы «A1-». Статистиче­ский анализ ANOVA показал, что группы «A1+» и «A1-» значимо не различаются.

Таблица 6. Индекс утомления до и после утомления у гена DRD2

Области мозга

ИАР, Гц/ст.откл.

«A1+» группа

«A1–» группа

До утомления

После утомления

До утомления

После утомления

Лобная левая

3,72 (2,32)

4,18 (2,82)

4,65 (3,00)

5,18 (3,15)

Лобная правая

6,31 (2,84)

7,12 (3,32)*

7,27 (2,65)

7,77 (2,46)

Центральная левая

2,66 (1,40)

3,27 (1,72)

3,59 (2,81)

4,36 (2,45)

Центральная правая

2,78 (1,34)

4,16 (2,58)**

3,62 (2,95)

4,97 (2,57)**

Теменная левая

3,37 (2,91)

4,42 (3,41)

3,66 (3,09)

5,31 (3,04)**

Теменная правая

4,58 (4,17)

5,78 (5,02)

5,00 (3,90)

6,56 (3,89)**

Височная левая

2,49 (1,38)

3,96 (2,74)*

3,26 (2,46)

4,10 (2,33)*

Височная правая

2,97 (3,25)

3,92 (3,85)*

3,24 (2,15)

4,26 (2,70)*

Затылочная левая

3,14 (2,40)

4,44 (3,88)*

3,97 (3,08)

4,62 (2,57)*

Затылочная правая

3,11 (2,63)

4,38 (3,69)*

3,56 (2,58)

4,40 (2,27)*

* значимые изменения (p≤0,05);

** значимые изменения (p≤0,01)

Обсуждение результатов

Субъективные показатели

В субъективном состоянии после дли­тельной когнитивной нагрузки отмеча­ется снижение показателей по шкалам самочувствие и активность как у поли­морфизма A2A2, так и у полиморфиз­мов А1А1+А1А2. Многие исследователи отмечают, что после длительной когни­тивной деятельности испытуемые себя чувствуют намного хуже, чем до нее (Wijesuriya et al, 2007; Lorist et al., 2005; Trejo et al., 2005; Cheng, 2011). Так, Трейо обнаружил, что после трех часов реше­ния арифметических задач субъектив­ная оценка по шкалам энергичность и спокойствие значимо снижаются, а значение по шкале усталость – значимо возрастает (Trejo et al, 2005).

Таким образом, в целом можно за­ключить, что на субъективном уровне все полиморфизмы гена DRD2 испыты­вают утомление, и значимых различий в субъективных оценках между полиморфизмами выявлено не было.

Поведенческие показатели

В поведенческих реакциях было об­наружено значимое снижение скоро­сти в простой зрительно-моторной ре­акции, что может свидетельствовать о том, что испытуемые испытывали состо­яния утомления. Также наблюдалось уве­личение скорости реакции выбора с од­новременным увеличением количества ошибок. Это может также говорить о том, что испытуемые испытывали утомление и, пытаясь сохранить высокую скорость выполнения задания, они жертвовали точностью его выполнения. Различные исследования показали уменьшение ско­рости в ПЗМР с развитием умственного утомления (Lorist et al, 2005; Boksem et al, 2006; Trejo et al,2005). Некоторые ав­торы обнаружили, что при выполнении реакции выбора после длительной когнитивной нагрузки, наблюдается не уве­личение времени реакции, а ее сниже­ние (т.е. увеличение скорости), и вместе с этим возрастает количество ошибок. Этот эффект был назван «Компромиссом скорости и точности» (Wickelgren, 1977, Wood, 1976; Sternberg, 2004). Разные исследователи предлагали различные тео­рии объяснения этого феномена. Одной из основных является теория о том, что с увеличением времени выполнения за­дания, то есть с возрастанием утомления происходит смещение отношения меж­ду контролируемыми ответами на стимул и случайными ответами на него, который по латенции гораздо короче контролируемого. И по мере увеличения утомле­ния это соотношение смещается в сто­рону случайных ответов. Таким образом, при увеличении утомления происходит уменьшение скорости ответа и возраста­ние количества ошибок (Ollman, 1966; Yellott, 1971). Еще одной теорией, объя­сняющей уменьшение времени реакции выбора после длительной когнитивной нагрузки является гипотеза о том, что во время выполнения задания у испытуемо­го постоянно копится информация о уже выполненных заданиях, что позволяет ему быстрее отвечать на стимул, но из-за влияния утомления на когнитивную сфе­ру происходит увеличение количества ошибок (Knight, 1974).

Интересным фактом является то, что группа носителей полиморфизма А2А2 («А1»), который, как мы предполагали, бу­дет показывать меньшее развитие утомле­ния, характеризуется в ПЗМР и РВ значи­мо более медленным временем реакции и до и после длительной когнитивной на­грузки, по сравнению с носителями по­лиморфизмов А1А1 и А1А2 («А1+»). Сто­ит отметить, что динамика увеличения ошибок у всех полиморфизмов одинакова и по количеству ошибок генотипы не различаются ни до, ни после утомления. При этом направленность динамики измене­ния времени реакции после утомления у всех полиморфизмов примерно одина­кова. Это означает, что полиморфизмы различаются в ПЗМР и РВ не динамикой развития утомления, а физиологической предрасположенностью к сенсорной об­работке информации.

В максимальном теппинге носители А2А2 («А1-») полиморфизма характери­зуются значимым увеличением скоро­сти после когнитивной нагрузки, тогда как у «А1+» группы наблюдается замедление скорости, но незначимое.

Максимальный теппинг отражает мо­торный компонент – физиологическую способность организма к мышечному со­кращению, которая зависит, в том числе и от активности мотонейронов. В ПЗМР время реакции включает в себя помимо моторного компонента (непосредствен­ной реакции), также и информационный компонент (восприятие стимула). В РВ время реакции включает в себя, помимо вышеперечисленных компонентов, еще и когнитивный компонент (процесс оцен­ки и принятия решения, какую кнопку на­жать). Согласно полученным эксперимен­тальным данным, в ПЗМР время реакции у двух групп («А1+» и «А1-») значимо различается. В РВ – также наблюдается значи­мое различие двух групп полиморфизмов. В максимальном теппинге группы харак­теризуются разнонаправленной динами­кой изменения скорости реакции до и по­сле утомления, но незначимо.

Полученные результаты позволяют предположить положительную роль до­фамина в обеспечении протекания ин­формационной обработки. Об этом сви­детельствует тот факт, что носители полиморфизмов А1А1 и А1А2, которые характеризуются меньшей плотностью рецепторов к дофамину, отличаются зна­чимо более высокой скоростью реагиро­вания в ПЗМР и РВ, по сравнению с но­сителями А2А2 полиморфизма. При этом более значимые результаты получены в реакции выбора, которая требует гораздо большей информационной обработки. Данные максимального теппинга могут свидетельствовать о том, что у А2А2 но­сителей развитие утомления происходит медленнее, чем у А1А1+А1А2, так как они характеризуются ускорением скорости после длительной когнитивной нагрузки, тогда как носители А1-аллеля – характеризуются замедлением скорости. Родригес показал, что изменения в максимальном теппинге имеют центральное происхо­ждение (Rodrigues, 2009). Таким образом, увеличение скорости в максимальном теп­пинге связано с большей активацией мото­нейронов в головном мозге.

ЭЭГ показатели

Индивидуальный альфа ритм

В ходе анализа индивидуальной ча­стоты альфа-ритма, были также получе­ны интересные результаты. Показано, что носители А1-аллеля характеризуются большим снижением ИАР после утомле­ния, преимущественно в правом полуша­рии. Тогда как у группы «А1-» такого зна­чимого снижения обнаружено не было. У группы «А1-» снижение ИАР в среднем происходит с 9,86 Гц до 9,82 Гц. А у груп­пы «А1+» – с 10,05 Гц до 9,57 Гц.

Таким образом, мы видим, что группа «А1+» характеризуется не только мень­шим снижением ИАР, но и более высокой его частотой как до, так и после утомле­ния. В ряде исследований было показано, что пик альфа ритма положительно кор­релирует с такими процессами, как вни­мание, память, скорость сенсорной об­работки (Angelakis, 2004; Klimesh, 1999). Климеш показал, что испытуемые с вы­сокими мнестическими способностями и высокой скоростью обработки информации характеризуются частотой альфа пика в среднем на 1 Гц большей по срав­нению с контрольной группой (Klimesh, 1996, 1997). Испытуемые со сниженными мнестическими способностями характе­ризуются снижением пика альфа ритма во время выполнения заданий на память, а испытуемые с высокими мнестическими способностями характеризуются стабиль­ностью пика альфа ритма в различных условиях (Klimesh, 93). При длительном выполнении когнитивных заданий многие авторы отмечают снижение индивидуаль­ной частоты альфа ритма (Angelakis, 2004; Klimesh, 1999; Jap, 2009; Lal et al, 2007).

В целом, полученные результаты соот­ветствуют данным предыдущих исследо­ваний, согласно которым считается, что максимальный альфа ритм регистрирует­ся в затылочных и теменых областях при закрытых глазах (Кропотов, 2010; Голубе­ва, 2005). В ряде работ было также пока­зано увеличение мощности альфа ритма при умственном утомлении (Boksem et al, 2006; Trejo et all, 2005; Jap, 2009). Хотя не­которые исследователи отмечают умень­шение мощности альфа ритма после дли­тельной когнитивной нагрузки (Lal et al, 2007; Cheng, 2011). Климеш считает, что снижение мощности альфа ритма после когнитивной нагрузки, например, после арифметических задач происходит из-за того, что такая деятельность требует уча­стия рабочей памяти, что в свою очередь приводит к подавлению альфа ритма на ЭЭГ (Klimesh, 1997).

Индекс утомления

Индекс утомления отражает отноше­ние медленных мозговых ритмов к бы­стрым ((альфа+тета)/бета). Буди Томас Джап в своем исследовании показал, что алгоритм (альфа+тета)/бета имеет более сильное увеличение по сравне­нию с другими индексами (альфа/бета, (альфа+тета)/(альфа+бета), тета/бета) и является наиболее чувствительным к изменениям функционального состо­яния (Jap, 2009). Ченг с соавторами так­же продемонстрировали, что индекс (альфа+тета)/бета показывает более значимое изменение после длительной когнитивной нагрузки, по сравнению с другими индексами (тета/альфа, бета/ альфа) (Cheng, 2011).

В нашем исследовании по показате­лям индекса утомления значимых раз­личий между группами «А1+» и «А1-» полиморфизмами обнаружено не было. У группы «А1+» увеличение индекса утомления наблюдается в среднем с 3,51 до 4,56. У группы «А1-» увеличение ИУ наблюдается в среднем с 4,18 до 5,15.

Заключение

В настоящем исследовании мы в це­лом подтвердили нашу гипотезу о том, что носители полиморфизма A2A2 гена DRD2 характеризуются меньшим разви­тием утомления в условиях длительной когнитивной нагрузки по сравнению с носителями A1 аллеля (A1A1 и A1A2 полиморфизмы) по комплексу параметров (субъективных, поведенческих и электрофизиологических). Группа «А1+» – носители A1A1 и A1A2 полиморфизмов, ассоциированных с меньшей плотно­стью рецепторов дофамина и, соответ­ственно, с меньшим его уровнем, харак­теризуется снижением индивидуальной частоты альфа-ритма в обоих полушариях после когнитивной нагрузки, но при этом увеличением скорости простой зрительно-моторной реакции и реак­ции выбора. Группа «А-» характеризует­ся отсутствием изменений индивидуального альфа-ритма и более быстрым и стабильным значением максимального теппинга. Полученные результаты сви­детельствуют о положительной роли до­фамина в развитии утомления.

Исследование выполнено при поддержкегранта РГНФ № 14-06-00698a

Литература:

Голубева Э.А. Способности. Личность. Индивидуальность. – Дубна: «Феникс+», 2005. – 512 с.

Зинченко Ю.П., Тоневицкий А.Г., Веракса А.Н., Исайчев С.А., Леонов С.В., Меньшикова Г.Я., Стрелков Ю.К., Сысоева О.В., Черноризов А.М. Психология спорта. М.: Изд-во Моск. ун-та, 2011 – надо – Зинченко Ю.П., Тоневицкий А.Г., Веракса А.Н. и др. Психология спорта. – Москва: Изд-во Моск. ун-та, 2011.

Кропотов Ю.Д. Количественная ЭЭГ, когнитивные вызванные потенциалы мозга человека и нейротерапия. – Санкт-Петербург, 2010. – 506 с.

Angelakis, E., Lubar, J.F., Stathopoulou, S., & Kounios, J. (2004) Peak alpha frequency: an electroencephalographic measure of cognitive preparedness. Clin Neurophysiol. Apr; 115(4):887-97. doi: 10.1016/j.clinph.2003.11.034

Barnes, J.M., Dean, A.J., Nandam, L.S., & O’Connell, R.G. (2011) The Molecular Genetics of Executive Function: Role of Monoamine System Genes. Biological Psychiatry. Vol. 69, Issue 12, 127-143. doi: 10.1016/j.biopsych.2010.12.040

Binnie, C.D., Cooper, R., Mauguiere, F., Prior, P., & Tedman, B. (2003) Electroencephalography, Paediatric Neurophysiology, Special Techniques and Applications. Clinical Neurophysiology. Vol. 2.

Blomstrand, E. (2001) Amino acids and central fatigue. Amino Acids. Vol. 20, 25-34. doi: 10.1007/s007260170063

Blum, K., Braverman, E.R., Wu, S., Cull, J.G., Chen, T.J., & Gill, J. (1997) Association of polymorphisms of dopamine D2 receptor (DRD2), and dopamine transporter (DAT1) genes with schizoid/avoidant behaviors (SAB). Molecular Psychiatry. Vol. 2, 239-246. doi: 10.1038/sj.mp.4000261

Boksem, M.A., Meijman, T.F., & Lorist, M.M. (2006) Mental fatigue, motivation and action monitoring. Biol Psychol 72: 123–132. doi: 10.1016/j. biopsycho.2005.08.007

Bolton, J.L., Marioni, R.E., Deary, I.J., Harris, S.E., Stewart, M.C., Murray, G.D., Fowkes, F.G.R., & Price, J.F. (2010) Association between polymorphisms of the dopamine receptor D2 and catechol-o-methyl transferase genes and cognitive function. Behavior Genetics. Vol. 40, 630-638; doi: 10.1007/s10519-010- 9372-y

Cheng, Shyh-Yueh & Hsu, Hong-Te (2011) Mental Fatigue Measurement Using EEG, Risk Management Trends, Giancarlo Nota (Ed.), ISBN: 978-953- 307-314-9.

Davis, J.M., Alderson, N.L., & Welsh, R.S. (2000) Serotonin and central nervous system fatigue: nutritional considerations. The American Journal of Clinical Nutrition. Vol. 72, 573-8.

Davis, J.M., & Bailey, S.P. (1997) Possible mechanisms of central nervous system fatigue during exercise. Medicine and Science in Sport and Exercise. Vol. 29, 1, 45-57; doi: 10.1097/00005768-199701000-00008

Epstein, H.T. (1980) EEG developmental stages. Developmental Psychobiology. Vol. 13, 629–631. doi: 10.1002/dev.420130608

Farde, L., Gustavsson, J.P., & Jonsson, E. (1997) D2 dopamine receptors and personality traits. Nature; 385-590. doi: 10.1038/385590a0

Fernandez, T., Harmony, T., Rodriguez, M., Reyes, A., Marosi, E., & Bernal, J. (1993) Test–retest reliability of EEG spectral parameters during cognitive tasks: I. Absolute and relative power. International Journal of Neuroscience. Vol. 68, 255– 261. doi: 10.3109/00207459308994280

Fernstrom, J.D., & Fernstrom, M.H. (2006) Exercise, serum free tryptophan, and central fatigue. Journal of Nutrition. Vol. 136, 2, 553-559;

Foley, T.E., & Fleshner, M. (2008) Neuroplasticity of dopamine circuits after exercise: implications for central fatigue. NeuroMolecular Medicine. Vol. 10, 67-80; doi: 10.1007/s12017-008-8032-3

Goljahani, A., D’Avanzo, C., Schiff, S., Amodio, P., Bisiacchi, P., & Sparacino, G. (2012) A novel method for the determination of the EEG individual alpha frequency. Neuroimage. Vol. 60, 774-786. doi: 10.1016/j.neuroimage.2011.12.001

Gosso, M.F., de Geus, E.J.C., Polderman, T.J.C., Boomsma, D.I., Heutink, P., & Posthuma, D. (2008) Catechol O-methyl transferase and dopamine D2 receptor gene polymorphisms: evidence of positive heterosis and gene-gene interaction on working memory functioning. The American Journal of Human Genetics. Vol. 16, 1075-1082. doi: 10.1038/ejhg.2008.57

Jap, Budi Thomas, Lal, Sara, Fischer, Peter, & Bekiaris, Evangelos (2009) Using EEG spectral components to assess algorithms for detecting fatigue. Expert Systems with Applications. Volume 36, Issue 2, Part 1, 2352-2359.

Joyce, N.J., Sapp, D.W., & Marshall, J.F. (1986) Human striatal dopamine receptors are organized in compartments. PNAS. Vol. 83, 8002-8006. doi: 10.1073/pnas.83.20.8002

Kaasinen, V., Aalto, S., Nagren, K., & Rinne, J.O. (2004) Insular dopamine D2 receptors and novelty seeking personality in Parkinson’s disease. Movement Disorders. Vol. 19, 11, 1348-1351. doi: 10.1002/mds.20191

Khaustova, S.A., Shkurnikov, M.U., & Tonevitsky, A.G. (2010) Short highly intense exercise causes changes in salivary concentrations of hydrocortisone and secretory IgA. Bull. Exp. Biol. Med.. Vol. 149, 5, 635–9. doi: 10.1007/s10517-010-1012-2

Kidd, K.K., Morar, B., Castiglione, C.M., Zhao, H., Pakstis, A.J., & Speed, W.C. et al. (1998) A global survey of haplotype frequencies and linkage disequilibrium at the DRD2 locus. Human Genetics. Vol. 103, 2, 211-227. doi: 10.1007/s004390050809

Klimesch, W., Schimke, H., & Pfurtscheller, G. (1993) Alpha frequency, cognitive load and memory performance. Brain Topography, 5, 241-251. doi: 10.1007/BF01128991

Klimesch, W. (1996) Memory processes, brain oscillations and EEG synchronization. Int J Psychophysiol. doi: 10.1016/S0167-8760(96)00057-8

Klimesch, W. (1997) EEG-alpha rhythms and memory processes. International Journal of Psychophysiology. 26, 319-340. doi: 10.1016/S0167- 8760(97)00773-3

Klimesch, Wolfgang (1999) EEG alpha and theta oscillations reflect cognitive and memory performance: a review and analysis. Brain Research Reviews. 29,169–195. doi: 10.1016/S0165-0173(98)00056-3

Knight, J.L. (1974) Speed-accuracy tradeoff in double stimulation: Effects on the first response. Memory & Cognition, Vol. 2, 3, 522-532. doi: 10.3758/ BF03196915

Lal, Sara & Bekiaris, Evangelos (2007) The Reliability of Sensing Fatigue from Neurophysiology. AusWireless 2006: International Conference on Wireless Broadband and Ultra Wideband Communications Proceedings. EEG-based Estimation of Cognitive Fatigue. URL.: http://hdl.handle.net/10453/19642 ). - (reference date: 09.08.2016)

Lorist, Monicque, Boksem, Maarten, Ridderinkhof, Richard (2005) Impaired cognitive control and reduced cingulate activity during mental fatigue. Cognitive Brain Research. 24, 199– 205; doi: 10.1016/j.cogbrainres.2005.01.018

Malyuchenko, N., Schegolkova, J., Kulikova, M., Timofeeva, M., Shlepzova, V., Sysoeva, O., Ivanitsky, A., & Tonevitsky, A. (2010) Effects of Genetic Variations in the Dopaminergic System on Fatigue in Humans: Gender Aspects. Bulletin of Experimental Biology and Medicine. Vol. 149, 226-232; doi: 10.1007/s10517-010-0913-4

Meeusen, R., & Watson, P. (2007) Amino acids and the brain: do they play a role in “central fatigue”? International journal of sport nutrition and exercise. Suppl. 17, 37-46;

Newsholme, E.A., & Blomstrand, E. (1995) Tryptophan 5-hydroxytryptamine and a possible explanation for central fatigue. Advances in Experimental Medicine and Biology. Vol. 384, 315-320; doi: 10.1007/978-1-4899-1016-5_25

Newsholme, E.A., Blomstrand, E., & Ekblom, B. (1992) Physical and mental fatigue: metabolic mechanisms and importance of plasma amino acids. British Medical Bulletin. Vol. 48, 477–95;

Nieoullon, André (2002) Dopamine and the regulation of cognition and attention. Progress in Neurobiology. Vol. 67, Issue 1, 53–83; doi: 10.1016/S0301- 0082(02)00011-4

Ollman, R. (1966) Fast guess in choice reaction time. Psychonomic Science. 6, 155-156; doi: 10.3758/BF03328004

Petersen, I., & Eeg-Olofsson, O. (1971) The development of the electroencephalogram in normal children from the age of 1 through 15 years – Non-paroxysmal activity. Neuropädiatrie. Vol. 2, 375–404; doi: 10.1055/s-0028-1091786

Polikanova, I.S., Sysoeva, O.V., & Tonevitsky, A.G. (2012) Association between serotonin transporter (5HTT) and mental fatigue development. Psikhologicheskie Issledovaniya, Vol. 5, 24, 7. http://psystudy.ru  (in Russian, abstr. in English) - (reference date: 09.08.2016).

Reuter, M., Roth, S., Holve, K., & Hennig, J. (2006) Identification of first candidate genes for creativity: A pilot study. Brain Research. Vol. 1069, 190-197. doi: 10.1016/j.brainres.2005.11.046

Ritchie, T., & Noble, E.P. (2003) Association of seven polymorphisms of the D2 dopamine receptor gene with brain receptor-binding characteristics. Neurochemical Research. Vol. 28, 73-82; doi: 10.1023/A:1021648128758

Rodrigues, Julian, Mastaglia, Frank, & Thickbroom, Gary (2009) Rapid slowing of maximal finger movement rate: fatigue of central motor control? Exp Brain Res. doi: 10.1007/s00221-009-1886-2

Salamone, J.D. (2010a) Involvement of nucleus accumbens dopamine in behavioral activation and effort-related functions. In: Eds. Iversen L.L., Iversen S.D., Dunnett S.B., & Bjorkland A. Dopamine handbook. Oxford, UK, Oxford University Press.

Salamone. J.D. (2010b) Motor function and motivation. In: Eds. Koob, G., Le Moal, M., Thompson, R.F. Encyclopedia of behavioral neuroscience. Vol. 3. Oxford, Academic Press, 267–276. doi: 10.1016/B978-0-08-045396-5.00247-5

Salamone, J.D., Aberman, J.E., Sokolowski, J.D., & Cousins, M.S. (1999) Nucleus accumbens dopamine and rate of responding: Neurochemical and behavioral studies. Psychobiology. Vol. 27, 236-247.

Shkurnikov, M.U. et al. (2008) Free testosterone as marker of adaptation to medium-intensive exercise. Bull. Exp. Biol. Med. Vol. 146, 3, 354–7. doi: 10.1007/s10517-008-0292-2

Sternberg, Saul (2004) Reaction-Time Experimentation. Psychology 600-301/ Proseminar in Psychological Methods. Spring Semester.

Thompson, J. et al. (1997) D2 dopamine receptor gene (DRD2) TaqI A polymorphism: Reduced D2 receptor binding in the human striatum associated with the A1 allele. Pharmacogenetics. Vol. 7, 6, 479-484. doi: 10.1097/00008571-199712000-00006

Trejo, L., Knuth, K., Prado, R., Rosipal, R., Kubitz, K. Kochavi, R., Matthews, B., & Zhang, Y. (2007). EEG-Based Estimation of Mental Fatigue: Convergent Evidence for a Three-State Model. HCI International 2007 and Augmented Cognition International Conference, Beijing, 22-27 July 2007. In D.D. Schmorrow, & L.M. Reeves (Eds.), Augmented Cognition, HCII 2007, LNAI 4565, 201-211. New York: Springer LNCS.

Tsai, S.J., Yu, Y.W., Lin, C.H., Chen, T.J., Chen, S.P., & Hong, C.J. (2002) Dopamine D2 receptor and N-methyl-D-aspartate receptor 2B subunit genetic variants and intelligence. Neuropsychobiology. Vol. 45, 128-1. doi: 10.1159/000054951

Trejo, L., Knuth, K., Prado, R., Rosipal, R., Kubitz, K. Kochavi, R., Matthews, B., & Zhang, Y. (2007). EEG-Based Estimation of Mental Fatigue: Convergent Evidence for a Three-State Model. HCI International 2007 and Augmented Cognition International Conference, Beijing, 22-27 July 2007. In D.D. Schmorrow, & L.M. Reeves (Eds.), Augmented Cognition, HCII 2007, LNAI 4565, 201-211. New York: Springer LNCS. doi: 10.1007/978-3-540-73216-7_23

Wickelgren, Wayne (1977) Speed-accuracy tradeoff and information processing dynamics. Acta Psychologica. Volume 41, Issue 1, February 1977, 67–85; doi: 10.1016/0001-6918(77)90012-9

Wijesuriya, Nirupama, Tran, Yvonne, Craig, Ashley (2007) The psychophysiological determinants of fatigue. Int J Psychophysiol. doi: 10.1016/j. ijpsycho.2006.08.005

Wood, C.C., & Jennings, J.R. (1976) Speed-accuracy tradeoff functions in choice reaction time: Experimental designs and computational procedures. Perception & Psychophysics. Vol. 19, 92-102; doi: 10.3758/BF03199392

Yellott, John (1971) Correction for fast guessing and the speed-accuracy tradeoff in choice reaction time, Journal of Mathematical Psychology. 8, 159-199. doi: 10.1016/0022-2496(71)90011-3

Для цитирования статьи:

Поликанова И.С., Коршунов А.В., Леонов С.В., Веракса А.Н. Ассоциация рецептора к дофамину второго типа (DRD2) с развитием утомления в результате длительной когнитивной нагрузки. // Национальный психологический журнал. – 2016. – № 3(23). – С. 115-126.

Polikanova I.S., Korshunov A.V., Leonov S.V., Veraksa A.N. (2016). Association to dopamine receptor D2 (DRD2) with developing fatigue as a result of long-term cognitive load. National Psychological Journal. 3, 115-126.

О журнале Редакция Номера Авторы Для авторов Индексирование Контакты
Национальный психологический журнал, 2006 - 2017
CC BY-NC

Все права защищены. Использование графической и текстовой информации разрешается только с письменного согласия руководства МГУ имени М.В. Ломоносова.

Дизайн сайта | Веб-мастер